CHEM-527 Introductory Biochemistry

CHEM-527 Introductory Biochemistry Attenuation A bacterial cell must be sensitive to nutrients in its environment so that it does not waste energy synthesizing those compounds when they are available. For example, Escherichia coli can synthesize all of the amino acids found in proteins. If one or more of these amino acids becomes available, the biosynthetic pathways for them are shut down by end product inhibition and the synthesis of the enzymes of the pathways is repressed. As a result of DNA sequence and RNA sequence analysis combined with the physiologic response of various regulatory mutants, the fine control of the repression process is fairly well understood.

This problem will focus on the exquisite fine control known as attenuation. The following are some of the features of the attenuation mechanism quoted or paraphrased from Keller & Calvo, PNAS, 76, 6186-90 (1979).

i. Most transcription initiated at the relevant promotor terminates before the structural genes of the operon are reached, resulting in the synthesis of a leader RNA of about 150 nucleotides.

ii. The site at which termination occurs ("attenuator") is similar to previously identified transcription termination sites. It is a palindromic G-C rich region followed by a series of adenosines on the coding strand. The corresponding region of the leader RNA, which has a potential stem and loop structure followed by a series of uridines, is called the "terminator."

iii. Each of the known leader RNAs contains a second potential stem-and-loop structure proximal to the terminator and overlapping with it in such a way that pairing with one region precludes pairing with the other.

iv. Within each leader RNA, translational start and stop signals are positioned so that a peptide of 14-28 amino acids might be synthesized.

v. Each leader peptide contains in high frequency the amino acid corresponding to the particular operon.

vi. The derepression of the operon requires the transcriptional read-through of the attenuator. This occurs only if a ribosome initiates the synthesis of the leader peptide and is retarded in its progress by lower than normal amounts of a specific amino acyl tRNA. This favors a different conformation of the leader RNA and signals transcriptional read through.

Below is given the non-coding strand of DNA corresponding to the control region of a particular amino acid operon.

5'...ACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACC

ACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAA

ACACAGAMAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAG

GTAACGAGGTAACAACCATGGCGAGTGTTGAAGTTCGGCGGTACATCA...3'

1. Underline the transcriptional termination region. 2. This DNA sequence corresponds to that of the relevant leader RNA and mRNA. Circle the initiation and termination codons of the leader peptide.

3. Put a box around the initiation codon for the first structural gene.

4. Write the predicted amino acid sequence of the leader peptide above appropriate codons.

5. This sequence is derived from the control region of the operon for what amino acid?

6. Identify the palindromic region corresponding to the terminator with opposing arrows drawn above the sequences.

7. Identify the second palindromic region which overlaps the terminator with opposing arrows drawn under the sequences.

8. Depict in a general way the alternative base-paired structure possible for the leader RNA corresponding to the above sequence of DNA. Which conformation would be favored by low levels of the relevant amino acid?

9. Attenuation is an extremely elegant and finely tuned mechanism for controlling the expression of amino acid operons. One must consider that even higher order regulation is involved such as that between operons. Consider the metabolism of the amino acid you have identified in part 5 and the sequence of the leader peptide from part 4. What other amino acid seems to be important in controlling the expression of this operon? Does this make metabolic sense? If so, explain.

Return to CHEM-527 Home Page, Syllabus, or Departmental Home Page.
Last updated: 17 September 1999 by Hal White
Copyright 1999, Department of Chemistry and Biochemistry, University of Delaware, Newark, DE 19716